Cytochrome b gene heteroplasmy associated with QoI fungicide resistance in Venturia inaequalis populations from Northwestern Himalayas

Full abstract

Read the full abstract

Apple scab caused by the fungal pathogen Venturia inaequalis (Cke.) Wint. is one of the most destructive diseases of apple worldwide. To manage this disease and minimize economic losses, growers typically rely on multiple fungicide applications throughout the year. In the northwestern Himalayan region of India, particularly in Kashmir, the extensive and indiscriminate use of quinone outside inhibitor (QoI) fungicides has contributed to the emergence of V. inaequalis resistant strains. To assess this resistance, the baseline populations of V. inaequalis obtained from Anantnag and Srinagar districts were tested at seven different concentrations of QoI fungicides (0.001, 0.01, 0.05, 0.10, 0.50, 1.0, and 2.0 µg/ml) along with the control (0.001 µg/ml) to evaluate their mycelial growth response. The mean ED 50 values for Kresoxim-methyl 44.3% SC and Trifloxystrobin (25%) + Tebuconazole (50%) 75 WG were 0.122 and 0.042 µg/ml, respectively, with corresponding resistance factor of 4.16 and 5.13 and discriminatory dose of 0.13 and 0.050 µg/ml. The evaluation of exposed and baseline populations of V. inaequalis at these discriminatory concentrations revealed a significant shift in sensitivity. The most pronounced shift was observed in district Baramulla against Trifloxystrobin (25%) + Tebuconazole (50%) 75 WG, with a growth response of 21.77 per cent to 79.12 per cent against a baseline growth response of 28.87 per cent to 67.66%. In the case of Kresoxim-methyl 44.3% SC, the major shift was observed in Shopian with a growth response of 21.33 per cent to 79.77 per cent against the baseline growth response of 31.88 per cent to 60.28 per cent. The chemical-wise analysis unveiled that the highest frequency of resistant isolates was recorded against Kresoxim-methyl 44.3% SC (18.66%), followed by Trifloxystrobin (25%) + Tebuconazole (50%) 75 WG (18.00%). Although the mycelial growth assay was effective for detecting resistance, it did not elucidate the underlying molecular mechanism. To confirm this resistance, allele-specific polymerase chain reaction was employed by using single nucleotide polymorphism primer pair, viz., VictybF (GAGTAGACGGTAGTTAATGTATTC) and VictybR (CAAACCTTATGAGTGCTATACCGT). This amplification successfully yielded a 216 bp targeted fragment in all V. inaequalis isolates showing resistance to QoI fungicides. The sequencing of the amplified product revealed heteroplasmy at codon G143A, explaining the variability in resistance among isolates. This research confirms the first report of QoI fungicide resistance in V. inaequalis from Kashmir valley and highlights the rapid emergence of resistant populations and emphasizing the urgent need for the adoption of integrated fungicide resistance management strategies to sustain effective disease control.